Introduction

Loxostege Hübner, [1825] is one of the largest genera in Pyraustinae and shows the most diverse life history adaptations. For Loxostege, more than 85 species have been described by traditional morphological methods worldwide (SCHOLTENS & SOLIS, 2015; TRANKNER et al., 2009). In recent years, using traditional morphological methods as well as molecular techniques has become one of the most important developments in Lepidoptera taxonomy and systematics (CHEN et al., 2019; HAUSMANN et al., 2011; SERAPHIM et al., 2018; ZOU et al., 2016). According to other molecular markers, the mitochondrial cytochrome oxidase subunit 1 (COI) gene is the most preferred marker in taxonomy, classification and revision of Lepidoptera. (BUCHNER et al., 2018; KEMAL et al., 2018). Since the mtCOI gene has been used in Lepidoptera molecular systematics, it has been controversial. Because the COI gene is rapidly evolving and it is thought that it cannot fully reflect the phylogeny due to the possibility of high homoplasy due to the rapid saturation of the third codon positions (SOUZA et al., 2016). In contrast, there are numerous studies supporting large-scale datasets that most of the phylogenetic signals are in the third codon position. In addition, the mtCOI gene has significant potential to identify a single species and characterize species boundaries. The variation rate among species is low but the different nucleotide substitution ratios show a higher correlation in determining genetic distances than in other genes (KÄLERSJÖ et al., 1999; RACH et al., 2017).

A better understanding of Loxostege phylogeny requires an expansion of the taxon and genome samplings from different geographical locations. In recent years, complete or nearly complete mtCOI gene (658bp) from some Loxostege species which are obtained only North America, west Europa and China have been sequenced (CHEN et al., 2019). Since they are serious economic pest of both crops and weeds worldwide, the molecular aspects of Loxostege sticticalis (Linnaeus, 1761), L. cereralis (Zeller, 1872), L. allectalis(Grote, 1877) and L. commixtalis (Walker, 1866) within the genus have been studied. However, the phylogenetic relationship of Loxostege based on mtCOI sequences has not been discussed comprehensively. Although it is represented by 10 species (Loxostege aeruginalis (Hübner, 1796), L. bicoloralis (Warren, 1892), L. clathralis (Hübner, [1813]), L. mucosalis (Herrich-Schäffer, 1848), L. peltalis (Eversmann, 1842), L. peltaloides (Rebel, 1932), L. sticticalis (Linnaeus, 1761), L. turbidalis (Treitschke, 1829), L. wagneri (Zerny, 1929) and L. ayhanana Kemal & Koçak, 2017) (KEMAL & KOÇAK, 2017) in Turkey, there have been almost no significant information regarding molecular of Loxostege.

The molecular barcoding of L. ayhanana from East Turkey was presented for first time in this study, while the phylogenetic relationships of this species with other species in the genus Loxostege were elucidated based on their COI gene. Here, the phylogenetic tree was created at the genera in the subfamily Pyraustinae and the relations of these genera at the molecular taxonomy level were evaluated.

Methods

Loxostege ayhanana specimen (paratype/Lep-Pyr022) was used from Centre for Entomological Studies Ankara (Cesa) Collection for this study (Fig. 1). Total gDNA was extracted from femur part of legs using RED Extract-N-Amp Tissue PCR Kit (Sigma, St. Louis, MO, USA) according to manufacturer instructions and KEMAL et al. (2018). The dry legs of individual specimen were washed three times in 100 µL of fresh ethanol (70%). LepF1: ATTCAACCAATCATAAAGATATTGG and LepR1: TAAACTTCTGGATGTCCAAAAAATCA primers (HEBERT et al., 2004) were used for the PCR amplification of mtDNA COI gene. Cycling parameters for PCR amplifications were as follows: Initial denaturation at 94ºC for 2 min, 5 cycles of 94ºC for 30 sec, annealing at 45ºC for 40 sec, and extension at 72ºC for 1 min, 35 cycles of 94ºC for 30 sec, annealing at 51ºC for 40 sec, and extension at 72ºC for 1 min, final extension at 72ºC for 10 min. PCR products were electrophoresed in 1% TAE agarose gels, stained with GelRed, and visualized under UV light. The PCR products were sequenced bi-directionally Macrogen (Netherlands) with LepF1 and LepR1 primers in order to decrease the occurrence of sequencing error by commercial companies. Obtained the sequences were aligned by CodonCode Aligner Programs and their quality was checked and the sequence has been deposited in GenBank (https://www.ncbi.nlm.nih.gov/) with accession number MK883478. Other additional sequences were downloaded from the NCBI/GenBank database and Boldsystem (https://www.boldsystems.org/index.php). Multiple sequence alignments were performed with the ClustalW algorithm implemented in MEGA 7.0 software (TAMURA et al., 2013).

A total of 160 taxa were employed for phylogenetic analysis, including used Udea ferrugalis (Hübner, 1796), Mecyna asinalis (Hübner, [1819]) and Metasia carnealis (Treitschke, 1829) as outgroup taxa. Sequence divergences between selected sequences were calculated using the Kimura 2-Parameter distance model (KIMURA, 1980) and neighbour-joining (NJ) tree was constructed in the program MEGA 7. Maximum-likelihood (ML) bootstrapping analyses were carried out with 1000 replicates using RA × ML Blackbox with the settings described by STAMATAKIS et al. (2008). ML analyses were conducted online using the CIPRES Portal v.3.3 (http://www.phylo.org/). A Bayesian inference (BI) analysis was performed using MrBayes 3.2.6 (RONQUIST & HUELSENBECK, 2003) using the Markov chain Monte Carlo algorithm. The program JModeltest v.2.1.7 (POSADA, 2008) selected the F81 evolutionary model as the best model according to the akaike information criterion for Bayesian inference. The program was run for 10,000,000 generations, with a sample frequency of 100 and a burn-in of 25000.

Results

The existing mtCOI (658bp) DNA barcodes of 27 genera in the subfamily Pyraustinae were used in phylogenetic analyses. ML, NJ, and BI analyses generated similar tree topologies, and three supported values on the NJ tree were shown in Figure 2. The molecular phylogenetic relationships show that the Loxostege comprises five main groups: Group A was contained fourteen species of Loxostege. In the Group B was only located Loxostege albiceralis (Grote, 1878) and had as sister positions with Arenochroa flavalis (Fernald, 1894) and Xanthostege plana (Grote, 1883) in same clade. Group C, which including L. ayhanana, is a sister to this clade.

The base frequencies were A = 31.6%, C = 14.4%, G = 14.9%, and T = 39.1% for the presented specimen. The sequence character analysis indicated that the GC frequency (29.3%) was apparently lower than the AT frequency (70.7%), which is consistent with the features of the mitochondrial genome for Lepidoptera.

In our phylogenetic tree, it was found that L. ayhanana is more closely related to five species than the other species of the genus even though three support values are low. As the NJ tree shows, L. aeruginalis (Hübner, 1796) branches as sister group with the L. virescalis (Guenée, 1854)-L. turbidalis (Treitschke, 1829)-L. comptalis (Freyer, 1848) clade, and L. deliblatica (Szent-Ivány & Uhrik-Meszáros, 1942) had a basal position. L. ayhanana formed a sister taxon to the branch comprising the above five congeners (Fig. 2). In addition, L. questoralis (Barnes & McDunnough, 1914), L. immerens (Harvey, 1875) and L. frustalis (Zeller, 1852) were showed as a sister group with the presented taxon and were located in Group C. L. nudalis in the group D was located within the clade consisted from the Achrya species. Similarly, L. sticticalis (Linnaeus, 1761) in the Group E had a sister position with the populations of Perispasta caeculalis (Zeller, 1875), Pagyda sounanalis (Legrand, 1966) and Hahncappsia mellinialis (Druce, 1899).

The genetic distances between these species with L. ayhanana are as follows: L. ayhanana and L. virescalis (Guenée, 1854) populations have the closest genetic distance 4.83%-5.00%. The second closest was L. deliblatica (Szent-Ivány & Uhrik-Meszáros, 1942) with genetic distance 4.99%. It has range 5.17-5.52% with L. turbidalis (Treitschke, 1829) populations, and has range 6.00-6.35% with L. aeruginalis (Hübner, 1796) populations. L. ayhanana has 6.55% genetic distance with L. comptalis (Freyer, 1848). The genetic distance between the L. sticticalis (Linnaeus, 1761) populations and the L. ayhanana was 7.43-7.61%.

Discussion and conclusions

The present work is the first detailed study of the phylogenetic position of the genus Loxostege in the subfamily. Although Loxostege contains numerous species of this genus in the world, including important species for biological and evolutionary studies as well as many species of economic importance, the diversity and relationships of these species are far from being well understood.

The genus Loxostege was not monophyletic taxon according to three support values in molecular phylogenetic analyses and had five distinct lineages (Fig. 2). Although monophyletic groups are generally formed among the different populations of species in presented tree, the monophyly of some species (L. egregialis (Munroe, 1976), L. oberthuralis (Fernald, 1894) and L. internationalis (Munroe, 1976)) should be questioned because of their settlements.

In the numerous studies were reported that only morphological data were unable to give unequivocal answers, but the combined analyses (morphological and molecular analyses) have given a robust phylogenetic estimate for Lepidoptera in recent years (CHEN et al., 2019; MALYSH, 2013; TRANKNER et al., 2009; WAHLBERG et al., 2005). In addition, it is emphasized that morphologically defined species should be supported with molecular analyses for species delimination or phylogenetic position (KEMAL et al., 2019; RAJPOOT et al., 2016). Therefore, for the first time in this study, the molecular evaluation of L. ayhanana in the genus was performed using the mtCOI sequence.

One of the factors in favouring the COI gene as an advantageous barcode gene is the apparent distinction power between species in Lepidoptera systematics. In addition, it has characteristic variations in which the distance between species and intraspecies does not coincide. So, the barcoding aperture of COI has been accepted as the most transparent point in the accuracy and reliability of barcode sequences. (MEYER & PAULAY, 2005; RACH et al., 2017). It is a common view for many researchers that a large number of molecular data is needed and that morphological, ecological and molecular synergy will reflect a correct taxonomic and higher level systematic study (KEMAL et al., 2019; RAJPOOT et al., 2016; TRANKNER et al., 2009; WAHLBERG et al., 2005).

The morphologically described L. ayhanana species is a typical member of the genus Loxostege (KEMAL & KOÇAK, 2017). The monophyly of L. ayhanana, which is a distinct species, also supported with the phylogenetic analysis and its genetic distance.

L. nudalis populations in the Boldsystem are in the Achyra clade in our phylogenetic tree (Fig. 2).

It is appropriate to change the name of this taxon to Achrya nudalis (Hübner, 1796). Also L. sierralis was identified by MUNROE (1976) with its four subspecies have been recognized. L. sierralis internationalis, L. sierralis sierralis and L. sierralis sanpetealis have been barcoded (658bp) and L. sierralis tularealis has no barcode record available hitherto in Genbank/Boldsystem. The barcode records of these three subspecies in the Boldsystem is given at the species level. In the phylogenetic tree presented in this study, it was shown for the first time that these three populations were different from L. sierralis at species level. The maximum genetic distance between L. sierralis and L. internationalis according to the Kimura 2 parameter is 3.70% and between L. sierralis and L. sanpetealis is 3.30%. There are three independent species.

After a year of the description of L. ayhanana from Turkey, another population has been reported from Crimea (SAVCHUK & KAJGORODOVA, 2018). However, in the present study, we did not have the opportunity to compare these two populations in a molecular level because the mtCOI data of Crimean population is not yet available. Clearly, mtCOI gene sequences for more species of Loxostege from more geographic locations require in order to elucidate the phylogeny of the genus.

In the submitted phylogenetic tree, the support values are relatively low thus multiple genes based on more extensive sampling along with new sinapomorphic morphological data are recommended for to overcome the low resolution of single gene analysis. In the present study, as there are the only mtCOI gene sequences of these taxa in the databank (Boldsystem and GenBank), phylogeny estimates were evaluated based on a single barcode. The kinds of some genera do not have molecular barcodes yet, while some genera do not have any molecular data of their type species. Most of the data was obtained from Neotropical and European samples. The phylogeny of this very rich subfamily can be enlightened. With numerous new records obtaining from different geographies. The relationships within the taxa are tried to resolve with this study, an initial one for future studies.

In the presented phylogenetic study, includes L. ayhanana, as well as the type species of the genus is L. aeruginalis (Hübner, 1796) and four valid species (L. deliblatica, L. comptalis, L. turbidalis and L. virescalis) in same clade. According to these results, it has been supported that L. ayhanana, which was previously defined morphologically new species, was an independent species by differentiating it from other species of Loxostege by molecular analyses.

Acknowledgments

This work was supported by the Research Council of Van Yüzüncü Yil University (YYUBAP, Project No.: FAP-2018-7229), Van, Turkey. Special thanks are due to Prof. Dr. Ahmet Ömer Koçak and Dr. Muhabbet Kemal Koçak for their continuous helps, comments and using Cesa collection.

BIBLIOGRAPHY

BUCHNER, P., KEMAL, M. & KIZILDAG, S., 2018.– Depressaria bayindirensis, a new species from the hystricella / taciturnaspecies-group (Depressariinae, Lepidoptera) from Turkey.– Miscellaneous Papers, 170: 1-12.

CHEN, K., LIU, Q., JIN, J. & ZHANG, D., 2019.– Revision of the genus Emphylica Turner, 1913 based on morphology and molecular data (Lepidoptera, Crambidae, Pyraustinae).– Zookeys, 836: 113-133.

HAUSMANN, A., HASZPRUNAR, G. & HEBERT, P. D. N., 2011.– DNA Barcoding the Geometrid Fauna of Bavaria (Lepidoptera): Successes, Surprises, and Questions.– Plosone, 6(2): e17134.

HEBERT, P. D. N., PENTON, E. H., BURNSJ, M. H. J. D. & HALLWACHS, W., 2004.– Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator.– PNAS, 101(41): 14812-14817.

KÄLERSJÖ, M., ALBERT, V. A. & FARRIS, J. S., 1999.– Homoplasy Increases Phylogenetic Structure.– Cladistics, 15: 91-93.

KEMAL, M., KIZILDAG, S. & KOÇAK, A. Ö., 2019.– On the Heterocera of Mt. Caragan (Philippines, Mindanao Is.) with some remarks (Lepidoptera).– Miscellaneous Papers, 190: 1-50.

KEMAL, M. & KOÇAK, A. Ö., 2017.– Description of a new species, Loxostege ayhanana sp. n. from East Turkey (Lepidoptera, Pyraloidea).– Miscellaneous Papers, 164: 1-4.

KEMAL, M., YILDIZ, I., KIZILDAG˘, S., UÇAK, H. & KOÇAK, A. Ö., 2018.– Taxonomical and molecular evaluation of Apochima Agassiz in East Turkey, with a description of a new genus (Lepidoptera, Geometridae, Ennominae).– Miscellaneous Papers, 169: 1-14.

KIMURA, M., 1980.– A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences.– Journal of Molecular Evolution, 16: 111-120.

MALYSH, J. M., 2013.– Molecular phylogenetics of the beet webworm Loxostege sticticalis (L.) (Pyraloidea, Crambidae) as inferred from 18S ribosomal RNA gene sequence.– Plosone, 12(2): 173-176.

MEYER, C. P. & PAULAY, G., 2005.– DNA Barcoding: Error Rates Based on Comprehensive Sampling.– PLoS Biology, 3(12): 2229-2238.

POSADA, D., 2008.– ModelTest: phylogenetic model averaging.– Molecular Biology and Evolution, 25(7): 1253-1256.

RACH, J., BERGMANN, T., PAKNIA, O., DESALLE, R., SCHIERWATER, B. & HADRYS, H., 2017.– The marker choice: Unexpected resolving power of an unexplored CO1 region for layered DNA barcoding approaches.– Plosone, 12(4): e0174842.

RAJPOOT, A., KUMAR, V. P., BAHUGUNA, A. & KUMAR, D., 2016.– DNA Barcoding and Traditional Taxonomy: An Integrative Approach.– International Journal of Current Research, 8(11): 42025-42031.

RONQUIST, F. & HUELSENBECK, J. P., 2003.– MRBAYES 3: Bayesian phylogenetic inference under mixed models.– Bioinformatics, 19: 1572-1574.

SAVCHUK, V. V. & KAJGORODOVA, N. S., 2018.– The first record of Loxostege ayhanana Kemal et Koçak, 2017 (Lepidoptera: Crambidae) from the Europe, with notes on its bionomy.– Caucasian Entomological Bulletin, 14(1): 83-85.

SCHOLTENS, B. G. & SOLIS, M. A., 2015.– Annotated check list of the Pyraloidea (Lepidoptera) of America North of Mexico.– Zookeys, 535: 1-136.

SERAPHIM, N., KAMINSKI, L. A., DEVRIES, P. J., PENZ, C., CALLAGHAN, C., WAHLBERG, N., SILVABRANDÃO, K. L. & FREITAS, A. V. L., 2018.– Molecular phylogeny and higher systematics of the metalmark butterflies (Lepidoptera: Riodinidae).– Systematic Entomology, 43(2): 407-425.

SOUZA, H. V., MARCHESIN, S. R. C. & ITOYAMA, M. M., 2016.– Analysis of the mitochondrial COI gene and its informative potential for evolutionary inferences in the families Coreidae and Pentatomidae (Heteroptera).– Genetics and Molecular Research, 15(1): gmr.15017428.

STAMATAKIS, A., HOOVER, P. & ROUGEMONT, J., 2008.– A rapid bootstrap algorithm for the RAxML Web servers.– Systematic Biology, 57(5): 758-771.

TAMURA, K., STECHER, G., PETERSON, D., FILIPSKI, A. & KUMAR, S., 2013.– MEGA6: Molecular Evolutionary Genetics Analysis version 6.0.– Molecular Biology and Evolution, 30(12): 2725-2729.

TRANKNER, A., LI, H. & NUSS, M., 2009.– On the systematics of Anania Hübner, 1823 (Pyraloidea: Crambidae: Pyraustinae).– Nota lepidopterologica,32(1): 63-80.

WAHLBERG, N., BRABY, M. F., BROWER, A. V. Z., JONG, R., LEE, M. M., NYLIN, S., PIERCE, N. E., SPERLING, F. E. H., VILA, R., WARREN, A. D. & ZAKHAROV, E., 2005.– Synergistic effects of combining morphological and molecular data in resolving the phylogeny of butterflies and skippers.– Procceedings of The Royal Society, 272: 1577-1586.

ZOU, Y., SANG, W., HAUSMANN, A. & AXMACHER, J. C., 2016.– High phylogenetic diversity is preserved in species-poor high-elevation temperate moth assemblages.– Scientific Reports, 6: 23045.