On the biology, ecology and conservation of Jordanita (Gregorita) hispanica (Alberti, 1937) (Lepidoptera: Zygaenidae, Procridinae)

Sobre la biología, ecología y conservación de Jordanita (Gregorita)hispanica (Alberti, 1937) (Lepidoptera: Zygaenidae, Procridinae)

Introduction

The family Zygaenidae is an important model for ecological, environmental, zoogeographic, karyological, biochemical and taxonomical investigations (EFETOV et al., 2004, 2010, 2014b, 2014c, 2015, 2016, 2018; EFETOV & KNYAZEV, 2014; EFETOV & SAVCHUK, 2009; EFETOV & TARMANN, 2017a; KNYAZEV et al., 2015; CAN CENGIZ et al., 2018; CAN et al., 2019; TARMANN, 2019) in Lepidoptera. Its systematics is well established. According to the contemporary classification the family Zygaenidae consists of five subfamilies: Inouelinae Efetov & Tarmann, 2017; Procridinae Boisduval, 1828; Chalcosiinae Walker, 1865; Callizygaeninae Alberti, 1954; and Zygaeninae Latreille, 1809 (EFETOV, 1999, 2001a, 2001b, 2004; EFETOV et al., 2014a; EFETOV & TARMANN, 2017a; TARMANN, 1994). Many species have been recently described (see e. g. EFETOV, 1997a, 1997b, 1998, 2006, 2010; EFETOV & TARMANN, 2013a, 2013b, 2014a, 2014b, 2016a, 2016b, 2017b; MOLLET, 2018; MOLLET & TARMANN, 2018; TARMANN & COCK, 2019; TARMANN & DROUET, 2015). However, even in Western Europe the biology and early stages of some species are poorly studied or even unknown. A good example is Jordanita (Gregorita) hispanica (Alberti, 1937), a species known from Spain, Portugal and France.

The Iberian Peninsula is one of the richest European regions for endemism in the Zygaenidae. Five forester moths (Procridinae), viz. Rhagades (Wiegelia) predotae (Naufock, 1930), Adscita (Adscita) jordani (Naufock, 1921), .. (..) schmidti (Naufock, 1933), ((Tarmannita) bolivari (Agenjo, 1937), and Jordanita (Jordanita) vartianae (Malicky, 1961), and one burnet moth (Zygaeninae), viz. Zygaena (Agrumenia) ignifera Korb, 1897, are endemic and one more Procridinae, viz. Jordanita (Gregorita) hispanica (Alberti, 1937) and two Zygaeninae, viz. Zygaena (Mesembrynus) contaminei Boisduval, 1834, and Z. (Zygaena) anthyllidis Boisduval, 1828, are subendemic to the Iberian Peninsula. This high endemism is based on the exceptional environmental situation here with long isolation and independent development of wildlife during the last glacial periods. Today, the extreme changes of the environment in Spain because of the climatic changes in the last decades – and from other causes – require careful documentation of these highly endangered endemic species. To protect them and to prevent their extinction, intensive field work and monitoring of these environmental changes are required. A profound knowledge of the biology and ecology of endemic species is crucial for this purpose. The authors have repeatedly studied these endemisms. One species, viz. Jordanita hispanica, is discussed in this paper.

Materials and methods

The first field studies on J. hispanica go back to the year 1978 when a colony was discovered by G. M. T. in the south-western Alps on Mont Ventoux in the Department Vaucluse in southern France. Females were observed ovipositing on Centaurea paniculata L. (Asteraceae) (TARMANN, 1992; NAUMANN et al., 1999; EFETOV & TARMANN, 1999). A few larvae were reared from these eggs until L3 on Centaurea jacea L. and C. scabiosa L. in captivity, but then died. In Spain the observations of G. M. T. started in 1979 in the Provinces Cuenca and Madrid. However, it was not before both authors of this study undertook a joint field trip to Spain in 2002 that a female was found, eggs were obtained and the species could be reared from egg to imago for the first time.

Description of the life history of Jordanita hispanica

HABITATS

1. FRANCE, Vaucluse, Mont Ventoux south side, Forêt de la Perache, 1180 m: rocky calcareous plateau (Cretaceous limestone) with Mediterranean steppe vegetation in open Quercus pubescens forest.

2. SPAIN, Segovia, east of San Rafael, El Espinar, 1260 m: dry, rocky slope beside open pine forest (Fig. 1).

OVIPOSITION

The first oviposition was observed in nature on 24 July 1978 by G. M. T. at noon (around 12 o’clock, summer time) on the stems below and on the calyx of flowering Centaurea paniculata L. (Asteraceae) plants at Forêt de la Perache. A second oviposition was observed on 15 June 2002 by K. A. E. & G. M. T. at El Espinar, again at noon (exactly at 12 o’clock, summer time) on Centaurea cf. ornata Wild., again singly and on the calyx of the flower heads. When ovipositing the female bends its abdomen downwards and attaches the eggs singly or in a short row (the eggs not touching each other) on the surface of the plant.

EGG (Fig. 2)

The egg is ovoid, length 0.7 mm, breadth 0.4 mm, height 0.3 mm, and of whitish yellow (EFETOV & TARMANN, 2003) or yellowish green colour (NAUMANN et al., 1999).

LARVA (Figs 3-5)

First instar (L1). Final length before moulting 0.9-1.0 mm, breadth 0.3 mm. Body whitish yellow, head and anal comb brown. The setal formula of the first abdominal segment is: D: 1d, 1l.; SD: 0d, 1l; L: 0d, 2l (the terminology of the setae follows EFETOV et al. (2006) and EFETOV & HAYASHI (2008): D = dorsal setae, SD = subdorsal setae, L = lateral setae,l = light, hair-like setae, .d = dark, stronger sclerotized setae). This setal combination is typical for the subgenera Gregorita Povolny & Smelhaus, 1951, Tremewania Efetov & Tarmann, 1999, and Jordanita Verity, 1946, of the genus Jordanita (EFETOV, 2001c; EFETOV & TARMANN, 2003). Duration of L1: 7 days.

Second instar (L2). Colour and pattern like first instar. Final length before moulting 2.2 mm, breadth 0.7 mm. Duration of L2: 12 days.

Third instar (L3) (Fig. 3). Final length before moulting 3.3 mm. Dorsolateral area differentiates into stripes and the pattern of the adult larva is already visible. Duration of L3: 1516 days.

Fourth instar (L4). Final length before moulting 3.5 mm. Mediodorsal line interrupted, forming a row of oval, dark brown spots that are embedded into a broad grey dorsal band; space between mediodorsal and lateral area (except dorsal verrucae) greyish yellow; lateral and basal lines absent, lateral area greyish brown dorsally, whitish brown ventrally; ventrolateral area light brown; dorsal verrucae light reddish brown, subdorsal, lateral and subventral verrucae brown; ventral part of larva crimson. Thoracic legs dark brown, abdominal prolegs crimson. Head dark brown; prothoracic plate dark brown with white mediodorsal line. Duration of L4 before hibernation: 22-26 days.

Hibernation in L4.

Fifth and sixth instars (L5, L6). Pattern like L4.

Seventh and eighth instars (L7, L8) (Figs 4-5). Final length before moulting of L8 12.5 mm. Mediodorsal line interrupted, forming a row of hammer-shaped (T-shaped), dark brown spots that are embedded into a broad grey dorsal band; a visible dorsolateral line is absent; space between mediodorsal and lateral area (except dorsal verrucae) whitish yellow; lateral and basal lines absent; lateral area greyish brown dorsally, whitish brown ventrally; ventrolateral area light brown; dorsal verrucae light reddish brown, subdorsal, lateral and subventral verrucae reddish brown; ventral part of larva light red. Thoracic legs dark brown, abdominal prolegs light red. Periteme of spiracles blackish brown. Head blackish brown; prothoracic plate dark brown with white mediodorsal line. Anal comb dark brown, with 12 setae. Except for the verrucae, body covered with sclerotized dark brown multispined macrotubercles. Dorsal verruca of first abdominal segment with 6 long, light setae and 24 short, dark setae. Duration of L8: 10 days.

PUPA (Fig. 6)

Length 7.5 mm. Head, thorax, wings and abdomen smooth, shiny, light brown; proboscis long but not extending beyond the end of the abdomen. Duration of pupal stage: 16 days.

COCOON

Length 12.0 mm, breadth 5.0 mm, spindle-shaped, white, constructed of loosely spun silk.

ADULTS (Figs 7-8)

The imagines emerge in the morning. Activity starts shortly after the sun arrives at the habitat when males and females are looking for flowers to obtain nectar. Copula takes place in early evening and lasts until next morning. The females oviposit during the hottest hours at midday.

The males of this species are found during day and night and are frequently attracted by UV light (DROUET, 2016).

It is also important to mention that during our observations in 2002 J. hispanica was frequently occurring sympatrically, syntopically and synchronously with Jordanita (Tremewania) notata (Zeller, 1847). Both species externally are extremely similar and cannot be distinguished in nature even by a specialist. Moreover, J. notata is more common than J. hispanica in central Spain.

Discussion

J. hispanica is the type-species of the subgenus Gregorita Povolny & Smelhaus, 1951 (by original designation). This subgenus is represented by 8 species of which 7 occur in North Africa. In Europe only J. hispanica is present, distributed in Portugal, Spain and France (Fig. 10) (EFETOV & TARMANN, 1999; FERNÁNDEZ-RUBIO, 2005; DROUET, 2016). In the male genitalia in all species of this subgenus the valva is without process and the phallus is characterised by an aedeagus that is broader distally, with a single cornutus on the vesica seminalis (Fig. 11). In the female genitalia of many species of Procridinae a special structure exists named ‘praebursa’. The praebursa is the strongly dilated distal part of the ductus bursae between the antrum and the corpus bursae (ALBERTI, 1954; EFETOV, 1996; EFETOV & TARMANN, 2014a, 2014b, 2016a). In the subgenus Gregorita this structure is present only in some North African species. In J. hispanica the female genitalia lack a praebursa (Fig. 12), the proximal part of the ductus bursae is funnel-shaped, smooth, with a slightly grooved structure distally (TARMANN & TREMEWAN, 1995).

The larvae of Gregorita are characterised by an inverted T-shaped sclerite (prothoracic plate) on the prothoracic segment, dorsal verrucae that are almost contiguous mediodorsally or mediodorsally fused to form a large, horizontal dorsal ‘spot’ on each segment and the pattern on the 10^th abdominal segment forms a characteristic ‘five-spot cluster’ (TARMANN & TREMEWAN, 1995; MOLLET, 2003).

As far as it is known, the females of all Gregorita species lay their eggs singly or in short rows and attach them either on the calyx on the flower head, the distal part of the stem or on the leaves of the larval host-plant. The larvae are either leaf-mining until pupation or feed freely after hibernation in the later instars depending of the larval host-plants (TARMANN & TREMEWAN, 1995; MOLLET, 2003).

Identification and additional information

For the conservation of a species it is essential that it can safely be identified. Only then it is possible to observe changes in its population density and to realise a decrease in the number of specimens and populations. Unfortunately, no stage of J. hispanica can be identified with certainty by habitus in nature. The early stages as well as the adults have to be collected. In the first case the larvae have to be reared to imago (by entomologists with some experience in Procridinae rearing) and the genitalia of the imagines have to be studied after dissection of the abdomen and the structures compared with the known literature. Therefore, we provide the necessary information below and include also two DNA-barcodes (EFETOV et al., 2019) for the genetic identification of early stages, adult specimens and parts of specimens of J. hispanica.

The holotype of this species (Figs 8-9) is deposited in Zoologische Sammlungen des Bayerischen Staates (ZSBS), Munich, Germany (EFETOV & TARMANN, 1999).

For the identification of the adults we provide the drawings of male and female genitalia of J. hispanica (Figs 11-12) and another Spanish species, viz. J. (Tremewania) notata (Zeller, 1847) (Figs 13-14), which is usually flying together with J. hispanica, has similar habitus and the same larval host-plant.

DNA barcodes (COI gene sequences) (EFETOV et al., 2019) of two male specimens of J. hispanica (SPAIN, Segovia, 1 km SE Navafría, 1300 m, 11-VI-2002, K. A. Efetov & G. M. Tarmann leg.) are listed below.

Genbank number HM386570:

AACACTTTATTTTATTTTTGGTGTTTGATCAGGAATAGTTGGTACATTATTAAGTGTTTT AATTCGTACAGAATTAGGAGCTCCAGGATCTTTAATTGGTGATGATCAAATTTATAATA CTATTGTTACCGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGT GGATTTGGAAATTGATTAGTTCCTTTAATATTAGGGGCTCCAGATATAGCTTTCCCACG AATAAATAATATAAGATTTTGACTTCTCCCCCCTTCATTAACTCTTTTAATTTCAAGAAG AATTGTAGAAACAGGAGCTGGAACAGGATGAACCGTTTACCCCCCTCTTTCATCTAAC ATTACTCATAGAGGAGGTTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGTATT TCTTCAATTTTAGGAGCAGTAAATTTTATCACAACTATTATTAATATACGACCTGATGGA ATATCATTTGATCAAATACCTTTATTCGTTTGAGCAGTGGGAATTACTGCTTTATTATTAT TGCTTTCTTTACCTGTATTAGCTGGAGCAATTACTATACTTTTAACTGATCGAAATCTTA ATACATCATTTTTTGATCCTGCAGGTGGGGGAGATCCAATTCTTTATCAACATTTATTT

Genbank number HM386571:

AACACTTTATTTTATTTTTGGTGTTTGATCAGGAATAGTTGGTACATTATTAAGTGTTTT AATTCGTACAGAATTAGGAGCTCCAGGCTCTTTAATTGGTGATGATCAAATTTATAATA CTATTGTTACCGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGT GGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCTCCAGATATAGCTTTTCCACG AATAAATAATATAAGATTTTGACTTCTCCCCCCTTCATTAACTCTTTTAATTTCAAGAAG AATTGTAGAAACAGGAGCTGGAACAGGATGAACTGTTTACCCCCCTCTTTCATCTAAC ATTGCTCATAGAGGAGGTTCTGTAGATTTAGCAATTTTTTCTTTACATTTAGCAGGTATT TCTTCAATTTTAGGAGCAGTAAATTTTATTACAACTATTATTAATATACGACCTAATGGA ATATCATTTGATCAAATACCTTTATTCGTTTGAGCAGTAGGAATTACTGCTTTATTATTAT TGCTTTCTTTACCTGTATTAGCTGGAGCAATTACTATACTTTTAACTGATCGAAATCTTA ATACATCATTTTTTGATCCTGCAGGTGGGGGGGATCCAATTCTTTATCAACATTTATTT

Habitat preference and conservation

The preferred habitats of J. hispanica are unfertilised, dry, sometimes rocky, meadows with a diverse flora that contain good numbers of the respective larval host-plant. Like many Procridinae this species is also dependent on a steady succession in the vegetation, created by natural conditions (e. g. by rock falls, moving scree, heavy winds etc.) or human activities (e. g. by wood cutting, continuous grazing etc.).

In the last years J. hispanica has become endangered on the Iberian Peninsula especially due to the dramatic climatic changes and the transformation of former suitable habitats into semideserts. In France several of the former habitats are now overgrown by dense forest (e. g. Forêt de la Perache, Mt. Ventoux).

In general J. hispanica should be able to survive these changes by shifting around through suitable habitats as it obviously did in history. However, continuous observations on its changing status could help to obtain a better overview of potential threats and population changes. For this, continuous field work is necessary. The Scientific Project of SHILAP on the Iberian Peninsula and the work of GIRAZ in France where experts monitor the population changes of Lepidoptera (including Zygaenidae) are good bases for preserving this rare species.

Agradecimientos

We thank Dr Antonio Vives (Spain) for his continuous help in obtaining the relevant collecting permits for our field work in Spain within the Scientific Project of SHILAP. We are indebted to Dr Axel Hausmann (Germany) for loan of the type material from ZSBS, to Dr V. L. Saenko (Russia) for help in the preparation of genitalia drawings and to Mrs E. E. Kucherenko (Russia) for technical support. We also thank Dr A. Spalding (Great Britain) for editing the English text.

BIBLIOGRAPHY

ALBERTI, B., 1954.– Über die stammesgeschichtliche Gliederung der Zygaenidae nebst Revision einiger Gruppen (Insecta, Lepidoptera).– Mitteilungenaus dem Zoologischen Museum der Humboldt-Universität Berlin, 30: 115-480.

CAN, F., EFETOV, K. A., BURMANN, J., KAYA, K., KUCHERENKO, E. E., ULARLI, B. & TARMANN, G. M., 2019.– A study of the Zygaenidae (Lepidoptera) fauna of Central Anatolia, Turkey.– Turkish Journal of Entomology (Türkiye Entomoloji Dergisi), 43(2): P. 189-199.

CAN CENGIZ, F., EFETOV, K. A., KAYA, K., KUCHERENKO, E. E., OKYAR, Z. & TARMANN, G. M., 2018.– Zygaenidae (Lepidoptera) of Thrace Region of Turkey.– Nota lepidopterologica, 41(1): 23-36.

DROUET, E., 2016.– Les Procris de France, French Forester Moths (Lepidoptera, Zygaenidae, Procridinae & Chalcosiinae): 128 pp. Roland Robineau édition, Thoury-Férottes.

EFETOV, K. A., 1996.– The description of the female of Illiberis .Alterasvenia. yuennanensis Alberti, 1951 (Lepidoptera: Zygaenidae, Procridinae).– Entomologist’s Gazette, 47(2): 111-113.

EFETOV, K. A., 1997a.– Two new species of the genus Artona Walker, 1854 (Lepidoptera: Zygaenidae, Procridinae).– Entomologist’s Gazette, 48(3): 165-177.

EFETOV, K. A., 1997b.– Three new species of the genus Illiberis Walker, 1854, from Taiwan and Vietnam (Lepidoptera: Zygaenidae, Procridinae).– Entomologist’s Gazette, 48(4): 231-244.

EFETOV, K. A., 1998.– A revision of the genus Goe Hampson, [1893] (Lepidoptera: Zygaenidae, Procridinae), with descriptions of two new species.– Entomologist’s Gazette, 49(1): 49-62.

EFETOV, K. A., 1999.– Inouela gen. n. from Japan and Taiwan (Lepidoptera: Zygaenidae, Chalcosiinae).– Entomologist’s Gazette, 50(2): 91-95.

EFETOV, K. A., 2001a.– On the systematic position of Zygaenoprocris Hampson, 1900 (Lepidoptera: Zygaenidae, Procridinae) and the erection of two new subgenera.– Entomologist’s Gazette, 52(1): 41-48.

EFETOV, K. A., 2001b.– An annotated check-list of Forester moths (Lepidoptera: Zygaenidae, Procridinae).– Entomologist’s Gazette, 52(3): 153-162.

EFETOV, K. A., 2001c.– A Review of the Western Palaearctic Procridinae (Lepidoptera: Zygaenindae): 328 pp. CSMU Press, Simferopol.

EFETOV, K. A., 2004.– Forester and Burnet Moths (Lepidoptera: Zygaenidae). The genera Theresimima Strand, 1917, Rhagades Wallengren, 1863, Zygaenoprocris Hampson, 1900, Adscita Retzius, 1783, Jordanita Verity, 1946 (Procridinae), and Zygaena Fabricius, 1775 (Zygaeninae): 272 pp. CSMU Press, Simferopol.

EFETOV, K. A., 2006.– Nine new species of the genus Chrysartona Swinhoe, 1892 (Lepidoptera: Zygaenidae, Procridinae).– Entomologist’s Gazette, 57(1): 23-50.

EFETOV, K. A., 2010.– Illiberis .Hedina. louisi sp. nov. (Lepidoptera: Zygaenidae, Procridinae) from China.– Entomologist’s Gazette, 61(4): 235-241.

EFETOV, K. A., CAN, F., TOSHOVA, T. B. & SUBCHEV, M., 2010.– New sex attractant for Jordanitaanatolica (Naufock) (Lepidoptera: Zygaenidae: Procridinae).– Acta Zoologica Bulgarica, 62(2): 315-319.

EFETOV, K. A. & HAYASHI, E., 2008.– On the chaetotaxy of the first instar larva of Artonamartini Efetov, 1997 (Lepidoptera: Zygaenidae, Procridinae, Artonini).– Entomologist’s Gazette, 59(2): 101-104.

EFETOV, K. A., HOFMANN, A. & TARMANN, G. M., 2014b.– Application of two molecular approaches (use of sex attractants and DNA barcoding) allowed to rediscover Zygaenoprocris eberti (Alberti, 1968) (Lepidoptera, Zygaenidae, Procridinae), hitherto known only from the female holotype.– Nota lepidopterologica, 37(2): 151-160.

EFETOV, K. A., HOFMANN, A., TARMANN, G. M. & TREMEWAN, W. G., 2014a.– Taxonomic comments on the treatment of the Zygaenidae (Lepidoptera) in volume 3 of Moths of Europe, Zygaenids, Pyralids 1 and Brachodids (2012).– Nota lepidopterologica, 37(2): 123-133.

EFETOV, K. A., KIRSANOVA, A. V., LAZAREVA, Z. S., PARSHKOVA, E. V., TARMANN, G. M., ROUGERIE, R. & HEBERT, P. D. N., 2019.– DNA barcoding of Zygaenidae (Lepidoptera): results and perspectives.– Nota lepidopterologica, 42(2): 137-150.

EFETOV, K. A. & KNYAZEV, S. A., 2014.– New records of Jordanita (Roccia) volgensis (Möschler, 1862) (Lepidoptera: Zygaenidae, Procridinae) from Siberia (Russia) and Ukraine.– Entomologist’s Gazette, 65(3): 175-178.

EFETOV, K. A., KOSHIO, C. & KUCHERENKO, E. E., 2018.– A new synthetic sex attractant for males of Illiberis (Primilliberis) pruni Dyar, 1905 (Lepidoptera: Zygaenidae, Procridinae).– SHILAP Revista de lepidopterología, 46(182): 263-270.

EFETOV, K. A., KUCHERENKO, E. E., PARSHKOVA, E. V. & TARMANN, G. M., 2016.– 2-butyl 2dodecenoate, a new sex attractant for Jordanita (Tremewania) notata (Zeller, 1847) and some other Procridinae species (Lepidoptera: Zygaenidae).– SHILAP Revista de lepidopterología, 44(175): 519-527.

EFETOV, K. A., PARSHKOVA, E. V., BAEVSKY, M. Y. & PODDUBOV, A. I., 2014c.– Sec-butyl ester of dodecenoate: synthesis and attractive properties.– Ukrainian Biochemical Journal, 86(6): 175-182.

EFETOV, K. A., PARSHKOVA, E. V. & KOSHIO, C., 2004.– The karyotype of Illiberis (Primilliberis) rotundata Jordan, [1907] (Lepidoptera: Zygaenidae, Procridinae).– Entomologist’s Gazette, 55(3): 167-170.

EFETOV, K. A., PARSHKOVA, E. V., TARASOVA, L. G. & TARMANN, G. M., 2015.– The karyotypes of Procridinae (Lepidoptera: Zygaenidae), with the first record of the karyotype of Pollanisus commoni Tarmann, 2004, a representative of the tribe Artonini.– Entomologist’s Gazette, 66(2): 121-125.

EFETOV, K. A. & SAVCHUK, V. V., 2009.– The first record of Jordanita (Roccia) volgensis (Möschler, 1862) (Lepidoptera: Zygaenidae, Procridinae) from the Crimea.– Entomologist’s Gazette, 60(3): 155-158.

EFETOV, K. A. & TARMANN, G. M., 1999.– Forester Moths: 192 pp. Apollo Books, Stenstrup.

EFETOV, K. A. & TARMANN, G. M., 2003.– New data on the biology of Jordanita .Gregorita. hispanica (Alberti, 1937) (Lepidoptera: Zygaenidae, Procridinae), pp. 20-21.– In T. KEIL (ed.). Abstracts of the VIII Symposium on Zygaenidae (Dresden, 10-14 September 2003): 54 pp. Dresden.

EFETOV, K. A. & TARMANN, G. M., 2013a.– Illiberis .Alterasvenia. cernyi sp. nov. (Lepidoptera: Zygaenidae, Procridinae) from northern Thailand.– Entomologist’s Gazette, 64(1): 33-39.

EFETOV, K. A. & TARMANN, G. M., 2013b.– Chrysartona .Chrystarmanna. mineti sp. nov. (Lepidoptera: Zygaenidae, Procridinae) from northern Vietnam.– Entomologist’s Gazette, 64(3): 197-206.

EFETOV, K. A. & TARMANN, G. M., 2014a.– Illiberis .Alterasvenia. banmauka sp. nov. (Lepidoptera: Zygaenidae, Procridinae) from China and Myanmar.– Entomologist’s Gazette, 65(1): 62-70.

EFETOV, K. A. & TARMANN, G. M., 2014b.– A new European species, Adscita dujardini sp. nov. (Lepidoptera: Zygaenidae, Procridinae) confirmed by DNA analysis.– Entomologist’s Gazette, 65(3): 179-200.

EFETOV, K. A. & TARMANN, G. M., 2016a.– Pseudophacusamultidentata Efetov & Tarmann, a new genus and species of Procridini from Myanmar, China and Laos (Lepidoptera: Zygaenidae, Procridinae).– SHILAP Revista de lepidopterología, 44(173): 81-89.

EFETOV, K. A. & TARMANN, G. M., 2016b.– A new Illiberis species: I. .Alterasvenia. kislovskyi (Lepidoptera: Zygaenidae, Procridinae) from Myanmar.– Entomologist’s Gazette, 67(2): 137-142.

EFETOV, K. A. & TARMANN, G. M., 2017a.– The hypothetical ground plan of the Zygaenidae, with a review of the possible autapomorphies of the Procridinae and the description of the Inouelinae subfam. nov.– Journal of the Lepidopterists’ Society, 71(1): 20-49.

EFETOV, K. A. & TARMANN, G. M., 2017b.– Thibetana keili Efetov & Tarmann, a new species of the genus Thibetana Efetov & Tarmann, 1995, from Tibet (Lepidoptera: Zygaenidae, Procridinae, Artonini).– SHILAP Revista de lepidopterología, 45(180): 581-587.

EFETOV, K. A., TARMANN, G. M., HAYASHI, E. & PARSHKOVA, E. V., 2006.– New data on the chaetotaxy of the first instar larvae of Procridini and Artonini (Lepidoptera: Zygaenidae, Procridinae).– Entomologist’s Gazette, 57(4): 229-233.

FERNÁNDEZ-RUBIO, F., 2005.– Lepidoptera Zygaenidae.– Fauna Iberica, 26: 292 pp. Museo Nacional de Ciencias Naturales, CSIC, Madrid.

KNYAZEV, S. A., EFETOV, K. A. & PONOMARYOV, K. B., 2015.– Zygaenidae (Lepidoptera) from Omsk Region.– Zoologicheskii Zhurnal, 94(11): 1297-1302.

MOLLET, B., 2003.– Notes on the biology and ecology of the Jordanita species of North Africa (Lepidoptera: Zygaenidae, Procridinae).– Entomologist’s Gazette, 54: 171-178.

MOLLET, B., 2018.– Two new species and new data of the genus Chrysartona from Southern Vietnam and Laos (Lepidoptera Zygaenidae Procridinae Artonini).– Antenor, .(1): 79-83.

MOLLET, B. & TARMANN, G. M., 2018.– A new genus and a new species of Chalcosiinae from Southern Vietnam, with biological data on the subfamily (Lepidoptera Zygaenidae Chalcosiinae).– Antenor, .(2): 165-170.

NAUMANN, C. M., TARMANN, G. M. & TREMEWAN, W. G., 1999.– The Western Palaearctic Zygaenidae (Lepidoptera): 304 pp. Apollo Books, Stenstrup.

TARMANN, G. M., 1992.– Foodplants of the Zygaenidae subfamilies Procridinae and Chalcosiinae with notes on the biology and ecology of these two groups.– Proc. 4th Symposium on Zygaenides, Nantes 1987: 144-161.

TARMANN, G. M., 1994.– A preliminary review of the classification of the zygaenid subfamily Procridinae (Lepidoptera).– Nota lepidopterologica. Suppl., 5: 115-123.

TARMANN, G. M., 2019.– Vergleich der historischen und aktuellen Verbreitung von Chazarabriseis (Nymphalidae) und Zygaenidae (Lepidoptera) im oberen Vinschgau (Südtirol, Italien) zeigt ein komplettes Verschwinden der Zygaenidae in talnahen Gebieten.– Gredleriana19: 109-184.

TARMANN, G. M., & COCK, M. J. W., 2019.– Zygaenidae from Trinidad, West Indies.– Journal of the Lepidopterists’ Society, 73(3): 153-161.

TARMANN, G. M. & DROUET, E., 2015.– Zygaenidae from French Guiana, with a key to the narrow-winged Zygaenidae genera of the New World.– Journal of the Lepidopterists’ Society, 69(3): 209-235.

TARMANN, G. M. & TREMEWAN, W. G., 1995.– A revision of the North African Jordanita Verity, 1946, and Adscita Retzius, 1783: their taxonomy, biology and ecology (Lepidoptera: Zygaenidae, Procridinae).– Entomologist’s Gazette, 46(1): 3-56.

Author notes

*Autor para la correspondencia / Corresponding author efetov.konst@gmail.com